N A T U R K U N D L I C H E S   I N F O R M A T I O N S S Y S T E M

Stigmella assimilella (Zeller, 1848)

(zoological nomenclature: valid name, available)

General information:

Nepticula assimilella Zeller, 1848: 327.
Type locality: Austria, Vienna
Type: Syntypes : Austria, Vienna, in coll. NHM, London (Nieukerken 2014).

Synonyms, misspellings, wrong determinations, etc.:
Nepticula tremulaefoliella Sorhagen, 1922

Habit:

     
: schematic      
Picture from: Kurz Michael
Detailed view
     

Description of adults: : "Wingspan: 5.4-6.2 mm. Head: frontal tuft ochreous, sometimes mixed with brown; collar and scape yellowish white; antenna half length of forewing, fuscous. Thorax black, tips of tegulae and mesoscutum white. Forewing: coarsely scaled, brownish black with three whitish spots; one round spot at one third and two opposite, triangular spots at two thirds from wing base; terminal cilia pale yellowish, grey at tornus. Hindwing and cilia grey. Abdomen dark grey with short grey-brown anal tufts." (Nieukerken 2014).

: "Wingspan: 5.7-6.3 mm. Antenna slightly shorter than half length of forewing. Forewing black with more contrasting white spots and cilia. Abdomen fuscous with short dark grey brown anal tufts." (Nieukerken 2014).

Distribution:

The species is widespread in Europe, records missing only from the extreme west (Iceland, Ireland and Portugal), the Tyrrhenian Archipelago, Sicily, Greece and parts of the Balkans and European Russia (Karsholt & Nieukerken, 2011). Furthermore, the species has been found in eastern Siberia (Nieukerken 2014 following Puplesis 1985), although we do not know any records from the rest of Siberia (Dubatolov 2014). Vertically, the distribution has been documented from about sea-level to 560 m a.s.l. only (Kurz & Kurz 2014).

Biology:

S. assimilella has been found along wood edges and in Parks (Kurz & Kurz 2014). Following Nieukerken (2014), it is probably univoltine, with imagines from early June to early July and feeding larvae from mid July to Septemer, or even October (Kurz & Kurz 2014).

Stages in development:

     
Mine on Populus alba x tremula: Netherlands, Schiedam      
Picture from: www.bladmineerders.nl (CC-BY-NC-SA-2.5-NL)
Detailed view
     

Description of early stages following Nieukerken (2014):

Egg. The egg is laid on the upperside, usually beside a rib.

Larva. The larva is yellow. The mine starts as a narrow, contorted gallery, widening considerable in the later stage and often forming a false blotch. The larvae feed on Populus tremula and Populus alba (Kurz & Kurz 2014), but on the last plant only occasionally (Nieukerken 2014). The frass is a broken and relatively fine line throughout. The cocoon is brown to brownish black.

Anatomy:

   
-genitalia -genitalia    
Picture from: Kurz Michael (redrawn from Johansson et al. 1990)
Detailed view
Picture from: Kurz Michael (redrawn from Johansson et al. 1990)
Detailed view
   

Genitalia. "Vinculum tapering anteriorly with shallow to moderately deep emargination. Uncus subtriangular with square medial emargination and small but distinct paramedial notches. Gnathos with close-set, diverging horns on well sclerotized basal plate. Valva divided into long, pointed distal process and right to acute angled inner lobe. Transtilla with short, broad transverse bar and short, blunt sublateral processes. Aedeagus almost as long as genital capsule with 5-6 unilaterally sclerotized cornuti and a cluster of 10-15 sharply pointed spines, a few of which are longer and distinctly curved." (Nieukerken 2014).

Genitalia. Corpus bursae with band of scallop-shaped chitin plates surrounded by sparse and indistinct pectinations; posterior part narrow, strongly folded. Ductus spermathecae without spines. Apophyses posteriores slender and slightly longer than anteriores. Ovipositor not protruding, tip blunt." (Nieukerken 2014).

Diagnosis:

S. assimilella is easily separated from all other Stigmella-species by the three white forewing spots. Ectoedemia (Ectoedemia) quinquella (Bedell, 1848), being somewhat similar, has the spots differently arranged and has a black head (Nieukerken 2014).

Genetics:

Barcode data: "The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 11 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATATTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTC GAGCAGAATTAGGAAATCCAGGTTCATTAATTGGTGATGATCAAATTTATAATACAATTGTTACTGCTCATGCTTTTA TTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGTTTTGGAAATTGATTAGTACCGCTAATATTAGGAGCCC CTGATATAGCATTTCCTCGATTAAATAATATGAGATTTTGGTTACTGCCCCCTTCATTAACTTTACTAATTTCAAGAA GAATCGTCGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCACCTTTATCAGCTAATATTGCCCATAGAGGTGGTT CAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCATCTATTCTAGGAGCTATTAATTTTATCACTACAG TAATTAATATACGAGCTAATGGAATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAACTATTACTGCCTTAT TATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTT TTGACCCAGCTGGTGGAGGAGATCCTATTCTTTATCAACATTTATTTTGAT-- end --" (Nieukerken 2014).

Worth knowing:

Sources:

Dubatolov, V. V. 2014. Collection of Siberian Zoological Museum: Nepticulidae. http://szmn.sbras.ru/Lepidop/Nepticul.htm [online 2014.02.10].
Karsholt, O. & E. J. van Nieukerken 2011. Nepticulidae. In - Karsholt, O. & E. J. van Nieukerken (eds.). Lepidoptera, Moths. – Fauna Europaea version 2.4, http://www.faunaeur.org [online 2014.02.24].
Kurz, M. A. & M. E. Kurz 2000–2014. Naturkundliches Informationssystem. – URL: http://www.nkis.info [online 2014.02.24].
Nieukerken, E. J. van 2014: Nepticulidae and Opostegidae of the world. - URL: http://nepticuloidea.info/ [online 2014.02.24].
Zeller, P. C. 1848. Die Gattungen der mit Augendeckeln versehenen blattminierenden Schaben. Linnaea Entomologica 3: 248-344.

Publication data:

history:
Kurz Michael: 2014.02.28
Kurz Michael: 2015.11.18
Kurz Michael: 2016.08.01
Kurz Michael: 2016.08.06
not reviewed

Advertisement: